2.8. Szekvenálás - a bázissorrend meghatározása

Az előzőekben ismertetett gélelektroforézishez hasonló módszerrel megy egy DNS lánc bázissorrendjének meghatározása is. Nézzük tehát, hogyan olvashatunk el egy DNS láncot.

Az eredeti Sanger által bevezetett módszert mutatjuk be, amiért Sanger 1980-ban második Nobel-díját kapta. (Egyébként e kétszeres Nobel díjas angol biokémikus éppen a könyv megírása idején, 2013. őszén hunyt el Cambridge-ben 95 éves korában.)

Az eljárás során analóg nukleotidokat gyártunk le oly módon, hogy bennük a cukorrész 3' szénatom OH csoportját H-re cseréljük. Az így létrehozott didezoxi-adenin (ddA), didezoxi-citozin (ddC), didezoxi-guanin (ddG) és didezoxi-timin (ddT) molekulák szerkezete olyan, hogy bennük a 3' szénatomhoz nem tud másik molekula foszfodiészter-kötéssel kapcsolódni.

Ezek alapján módosítjuk a 2.5. alfejezetben leírt sokszorosító algoritmust. Négy lombikban fogjuk a sokszorosítást végezni, ezek mindegyikébe valamelyik didezoxi (analóg) molekulából is teszünk. Ez alapján fogjuk megkülönböztetni a lombikokat. Egy lombikban keletkezhet teljes duplaszálú DNS, de olyan is amit a polimeráz enzim nem tud folytatni, mert az eredeti nukleotid helyett annak analóg párját, didezoxi-nukleotidot tartalmaz. Ekkor a sokszorosítás után, ha újra denaturáljuk a molekulákat lesznek olyan egyláncú DNS-ek amik nem a teljes hosszúságúak, hanem valahol didezoxi-nukleotiddal fejeződnek be. Ezután a molekulák hosszának mérésével megállapítható, hogy az egyes lombikokban milyen hosszúságban játszódhatott le a kiterjesztés folyamata. Világos, hogy ezek a hosszak pontosan a lehetséges didezoxi-molekulák helyeit jelentik az adott lombikból. Viszont a didezoxi-molekula csak az ő analóg párjának megfelelő helyen lehet a molekulában, tehát az eredeti molekulában ezen a helyen az a nukleotid szerepelt, aminek analógját az adott lombik tartalmazza.

Így a négy analóg nukleotidokat (is) tartalmazó lombikra elvégezve a gélelektroforézist kapjuk meg az eredeti molekula nukleotidsorrendjét.

3. Példa. Tekintsük a AACGCTAATCGGCAGTGGGG láncot (5'-től 3' irány). Legyen adva a CCC primer molekula az eredeti lánc ismert 3' végéhez. Illetve ismert az is, hogy a molekula 5' vége A-val kezdődik.

Jelölje UA, UC, UG és UT rendre azokat a lombikokat, amelybe az eredeti molekulán, a négy (eredeti) nukleinsavon, és a polimeráz enzimen kívül tettünk didezoxi-adenin, didezoxi-citozin, didezoxi-guanin, illetve didezoxi-timin molekulákat.

Az eredeti AACGCTAATCGGCAGTGGGG lánchoz kötődő primerrel a következő molekulát kapjuk:


5'                    3' 
  AACGCTAATCGGCAGTGGGG 
                   CCC 
                 3'   5' 

Minden lombikban ilyen molekulákon indul a polimeráz enzim működése.

Vegyük az UA halmazt. Ebben az alsó szálon (3'-től 5' irányban) a következő láncok jönnek létre:


             ddACCCC 
      ddAGCCGTCACCCC 
   ddATTAGCCGTCACCCC 
TTGCGATTAGCCGTCACCCC 

Erre a lombikra elvégezve a gélelektroforézist azt kapjuk, hogy benne a nem teljes hosszúságú láncok hossza: 5, 12 és 15.

Ennek megfelelően az eredeti molekula 3' vége felől az 5., 12. és 15. helyen az A komplentere, vagyis a T áll.

A molekula bázissorrendje ennyi adatból a következő:


5'                    3'
  A....T..T......T.GGG  

Folytassa a feladatot, írja fel az UC , UG és UT lombikokban létrehozott nem teljes hosszúságú molekulákat, és fejtse meg az eredeti molekula bázissorrendjét. Töltse ki a hiányzó betűket a fenti sorban.

Van olyan szekvenálási módszer is ami olyan specifikus vágóenzimeken alapul, amelyek csak adott nukleotidnál vágnak. Ezt a kémiai szekvenálási módszert W. Gilbert és A. Maxam fejlesztették ki. Az ezekkel szétvágott (és a molekula speciálisan megjelölt elejét is tartalmazó) láncok hosszának mérésével hasonlóan meghatározható a bázissorrend, mint az általunk bemutatott módszerrel.

Ma már automata szekvenáló berendezések állnak rendelkezésre, amik emberi beavatkozás nélkül végzik a szekvenálást.